4c). 0015). Amazingly, diabetes starting point was correlated favorably with Th2-related GAD-specific IgG1 (< 10?4) AMD 070 and TGF-< 310?3). Furthermore, pancreatic lesions resembled Th2-related hypersensitive inflammation. These total results indicate, for the very first time, that GAD-DNA vaccination could increase diabetes and insulitis in NOD mice. In addition, our research shows that Th2/3 cells may possess potentiated cell damage. cells. In the NOD (non-obese diabetic) mouse model, this cell injury is thought to involve autoantigen-specific CD4 T cells with a Th1 phenotype and specific AMD 070 CD8 T lymphocytes [1]. Diabetogenic CD4 T cell clones usually produce Th1 cytokines [2] and many Th1 cells derived from islet infiltration of NOD mice and reactive to insulin can transfer diabetes [3]. However, both CD4 and CD8 subsets are required to transfer diabetes to neonate [4] or irradiated adult mice [5]. Mice lacking MHC class I molecules (NOD-in periphery [11] or in transgenic pancreatic cell autoantigen may enhance type I diabetes. Simultaneously with other studies, we decided to investigate the effect of injection of plasmid-DNA encoding 65 kDa GAD (GAD65) on diabetes and insulitis course in the NOD mouse. GAD65 is usually a crucial early target autoantigen involved in diabetes in the mouse [25,26]. Diabetes can be prevented by intrathymic [26] or intravenous [15,25] injections of recombinant GAD65 and by suppression of GAD expression in cells in antisense GAD-transgenic NOD mice [27]. Our approach was different from that of others. Given the known characteristics of the immune response induced by DNA vaccination against microbial or reporter antigens and to have conditions related closely to humans, we have chosen to study the effects of GAD65-plasmids in female NOD mice which developed a moderate diabetes incidence. Our study shows for the first time that GAD65-DNA vaccination can increase insulitis and diabetes in NOD mice. Surprisingly, GAD65-DNA immunization also induces a specific Th2/3 CD4 T cell response that may be implicated in diabetes worsening as GAD65-specific TGF-DNA polymerase, Promega, Madison, WI, USA) from GAD-pVEGT (kindly provided by T. Dyrberg) AMD 070 using a 5 oligonucleotide made up of the EcoRI digestion site (5GCGAATTCTAACATGGCATCTCCGGGCTC3, MWG, Ebersberg, Germany) and a 3 primer made up of the XbaI site (5GCTCTAGAGCTAAATCTTGTCCAAGGCG3). Pc-GAD was obtained by cloning EcoRI-XbaI-digested amplicons into pcDNA31/B (Invitrogen, Groningen, the Netherlands). The construct was controlled by sequencing (MWG). Recombinant protein produced by transient transfected mammalian cells (Hela-S3 AMD 070 and Nor-10) was detected by immunoblotting using GAD65-specific monoclonal antibodies (MoAb) GAD1 and GAD6 (data not shown). Plasmid and protein injections Anaesthetized female NOD mice AKAP7 were allocated randomly and injected at 3 and 8 weeks of age in each tibialis anterior muscle mass with 50 galactosidase (haplotype produce IgG2c (IgG2a/2c) instead of IgG2a. As commercial antimouse IgG2a antibodies identify IgG2a/2c differently [28], we decided beforehand that conjugated goat antimouse IgG2a antibody obtained from Caltag acknowledged IgG2a/2c efficiently. Antimouse IgG2a/2c (BD Biosciences) was used (02 < 005 was considered as significant. RESULTS GAD and Gal expression in injected muscle tissue GAD and < 310?3, Fig. 2a). At 42 weeks of age, diabetes incidence was 52% in pc-GAD mice 25%, 24% and 33% in PBS, unmanipulated and pc-LacZ groups, respectively. Concomitantly with diabetes aggravation, insulitis severity increased before diabetes onset in pc-GAD mice (< 710?3, Fig. 2b). More than 50% of the islets from pc-GAD mice were severely infiltrated 6 weeks after the second DNA injection, while severe insulitis affected only 25% and 10% of islets from pc-LacZ and PBS mice, respectively. After the second DNA injection, a slight increase in insulitis was observed in the pc-LacZ group (< 005). However, the course of insulitis in pc-LacZ mice did not lead to significant disease acceleration and mice injected with pc-LacZ displayed a diabetes incidence similar to that of PBS mice at the end-point of the study (Fig. 2a). Open in a separate window Fig. 2 Diabetes incidence and insulitis severity in GAD-DNA-vaccinated NOD mice. (a) Female NOD mice were injected at 3 (I1) and 8 (I2) weeks of age with 50 = 29), pc-LacZ (= 21),.
Related Posts
April 29, 2026