{"id":407,"date":"2024-09-24T12:50:57","date_gmt":"2024-09-24T12:50:57","guid":{"rendered":"http:\/\/www.rischool.org\/?p=407"},"modified":"2024-09-24T12:50:57","modified_gmt":"2024-09-24T12:50:57","slug":"a-3t3-l1-cells-were-stably-transfected-with-the-indicated-vectors-and-treated-without-or-with-oa","status":"publish","type":"post","link":"https:\/\/www.rischool.org\/?p=407","title":{"rendered":"\ufeff(A) 3T3-L1 cells were stably transfected with the indicated vectors and treated without or with OA"},"content":{"rendered":"<p>\ufeff(A) 3T3-L1 cells were stably transfected with the indicated vectors and treated without or with OA. depletion or overexpression drops or adds expression of GSK3 substrates, such as -catenin, c\/EBP,c-Myc, cyclin D1, and insulin receptor substrate 1, and cell growth\/survival. PLIN2 N or C terminus overexpression that Sigma-1 receptor antagonist 2 is associated with higher levels of the substrates suggests that those substrates bind to specific regions of PLIN2. Mimicking the possible high lipid concentrations in cells in the human body under conditions of hyperlipidemia\/obesity, OA-treated cells gain or reduce GSK3 substrate expression in parallel with a decrease (a Wnt-like effect) or increase in GSK3 activity, likely regulated by GSK3\/PLIN2\/GSK3 substrate associations. INTRODUCTION The PLIN family members are expressed in many species, including mammals, (1,C6), where they associate with intracellular neutral lipid storage droplets (LSDs) and control cellular lipolytic activity (1,C6). Strong sequence identity is found in PLIN proteins at their amino termini, whereas similarity in most of their other sequences is lower (1,C6). In the PLIN family, PLIN2 (ADRP) and PLIN3 (TIP47) are ubiquitously distributed in cells of mammals and are the most closely related (1,C6). The functions of the PLIN proteins other than the regulation of lipolysis are undefined (1,C6). Wnt signaling that activates -catenin\/TCF signaling (-CTS) is crucial to many metazoan developmental processes (7,C10). Without Wnt, adenomatous polyposis coli (APC) and axins scaffold with glycogen synthase kinase 3 (GSK3) and -catenin, causing -catenin phosphorylation and degradation, but Wnt ligands bind to coreceptors of Frizzled (Fz) and low-density lipoprotein (LDL) <a href=\"http:\/\/www.drought.gov\/portal\/server.pt\">Rabbit Polyclonal to Claudin 7<\/a> receptor-related proteins 5\/6 (LRP5\/6), which mediates the destabilization of the protein interactions within the axin\/GSK3\/-catenin complexes (AGC). Being no longer accessible to phosphorylation by GSK3, -catenin is accumulated and is able to interact with lymphoid enhancer factor\/T-cell factor (LEF\/TCF) to promote expression of Wnt class genes (7,C10). Mechanisms that underlie Wnt signal transmission to axin\/GSK3 are not fully elucidated. The Dishevelleds (Dvls) act downstream of the coreceptors and upstream of the axin complexes (7,C10); partly, Dvls involve cofunction with axin and GSK3 to phosphorylate LRP5\/6 Sigma-1 receptor antagonist 2 (11,C14), which is essential for Wnt\/-CTS and occurs almost simultaneously with Wnt-induced dissociation of axin\/GSK3 (15, 16). A previous study reports that Wnt-3a induces alterations in the interactions of Go with Fz and Dvl2 and that depletion of Go and Gq (Go\/q) inhibits normal Wnt\/-catenin signaling in Sigma-1 receptor antagonist 2 cultured cells (16). However, how Dvls deliver Wnt signaling to AGC in native mammalian cells is unknown. Some lipid studies show links with Wnt signaling. Dvl-lipid interactions affect Dvl signaling <a href=\"https:\/\/www.adooq.com\/sigma-1-receptor-antagonist-2.html\">Sigma-1 receptor antagonist 2<\/a> pathways (17). Moreover, caveolin, a lipid-interacting protein, can also mediate Wnt signaling (18). We wondered whether high lipid levels alter Wnt-induced -catenin stability and investigated a potential role of PLIN2 in Wnt signaling, which was the original objective of the study. After discovering that PLIN2 is a GSK3-associated protein, we focused more on the PLIN2 functions that mediate the effects of GSK3\/GSK3 Sigma-1 receptor antagonist 2 substrates. MATERIALS AND METHODS Cells. 3T3-L1 cells (murine preadipocytes), human embryonic kidney 293 (HEK293) cells, and THP-1 cells (cultured human monocytes) were obtained from the ATCC (Manassas, VA). 3T3-L1 cells were used before confluence was reached and were never allowed to exceed four passages. Unless noted, cells were treated with 500 ng\/ml Wnt-3a (R&#038;D Systems, Minneapolis, MN) for the times indicated in the figures. In oleic acid (OA) (Sigma-Aldrich, St. Louis, MO) treatment experiments, cells were cultured overnight in 400 M OA unless specifically indicated. siRNAs. Control small interfering RNA (siRNA), PLIN2 siRNA (human), PLIN2 siRNA1 (murine), Go\/q siRNAs (murine), and PLIN3 siRNA (human) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Murine PLIN2 siRNA2 was designed using an online tool from Qiagen (Germantown, MD) and synthesized by Qiagen. The target sequence AACGGCTGGAGTCCCTGTCTA is to murine PLIN2 (accession no. &#8220;type&#8221;:&#8221;entrez-nucleotide&#8221;,&#8221;attrs&#8221;:&#8221;text&#8221;:&#8221;NM_007408&#8243;,&#8221;term_id&#8221;:&#8221;2183243222&#8243;,&#8221;term_text&#8221;:&#8221;NM_007408&#8243;NM_007408). Both.<\/p>\n","protected":false},"excerpt":{"rendered":"<p>\ufeff(A) 3T3-L1 cells were stably transfected with the indicated vectors and treated without or with OA. depletion or overexpression drops&#8230;<\/p>\n","protected":false},"author":1,"featured_media":0,"comment_status":"closed","ping_status":"open","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[43],"tags":[],"class_list":["post-407","post","type-post","status-publish","format-standard","hentry","category-lxr-like-receptors"],"_links":{"self":[{"href":"https:\/\/www.rischool.org\/index.php?rest_route=\/wp\/v2\/posts\/407","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.rischool.org\/index.php?rest_route=\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/www.rischool.org\/index.php?rest_route=\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/www.rischool.org\/index.php?rest_route=\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/www.rischool.org\/index.php?rest_route=%2Fwp%2Fv2%2Fcomments&post=407"}],"version-history":[{"count":1,"href":"https:\/\/www.rischool.org\/index.php?rest_route=\/wp\/v2\/posts\/407\/revisions"}],"predecessor-version":[{"id":408,"href":"https:\/\/www.rischool.org\/index.php?rest_route=\/wp\/v2\/posts\/407\/revisions\/408"}],"wp:attachment":[{"href":"https:\/\/www.rischool.org\/index.php?rest_route=%2Fwp%2Fv2%2Fmedia&parent=407"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/www.rischool.org\/index.php?rest_route=%2Fwp%2Fv2%2Fcategories&post=407"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/www.rischool.org\/index.php?rest_route=%2Fwp%2Fv2%2Ftags&post=407"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}